Two vectors were generated and designated pET-Amp and pPICZαA-Amp. Here, a strategy for modification of these two vectors to be compatible with the Golden Gate assembly method is presented. PET-28a (+) and pPICZαA are popular and commercially available choices for heterologous expression in E. GCTCGAGCCT GAGACCTAAACTTGGTCTGACAGTTACCAATGCĪAA GGTCTCAAGCCCTTGGCGAGCTCGGTGACGAAGCCGACĪAA GGTCTCAGTTGTCTCCTGGGATGAAGCAATGTTTAACĪAA GGTCTCGTCTCACTGTAGCCGTCAGCGTTTAGTTCAACGGTCTTCĪAA GGTCTCAAGCCGTAATCGAAGTAAGAGTGAGCCTCATGG PrimerĪCTC GGTCTCAGGCTCGAGCCATCATCATCATCATCATTGAGTTTGTAGĪAA GGTCTCAGAGTCTCACTTAATCTTCTGTACTCTGAAGĪAA GGTCTCAGGCGTCTCTTTTTTCTTTTCCAAACCTTTAGTACGGGĪAA GGTCTCAGGATCCTCTTTTCTCCAAAGATACCCCTTCTTCTTTAGCAGCĬTCGAGCCT GAGACCGAGTAAACTTGGTCTGACAGTTACC The sequence of primers used for PCR and sequencing. Trichophyton rubrum reference strain was a gift from the China Agricultural University Veterinary Teaching Hospital and the extracted genome served as the genomic template. pastoris GS115 and plasmid pPICZαA were purchased from Invitrogen. Plasmid pET-28a (+) was purchased from Novagen. coli DH5α chemically competent cells and Plasmid Mini-prep kit were purchased from Tiangen Biotech. BsaI-HFv2 restriction enzyme, T4 DNA ligase and plasmid pUC19 were purchased from New England Biolabs. The PCR products were gel-purified with E.Z.N.A. All PCR reactions were performed with the Q5 ® High-Fidelity DNA Polymerases from New England Biolabs. Gray boxes represent introns blue lines represent the designed primers with BsaI restriction sites and polylines represent the BsaI restriction sites naturally carried by the exons.Īll primers were synthesized by Sangon Biotech and are listed in Table 1.
#SNAPGENE GOLDEN GATE CLONING SOFTWARE#
All plasmid vector maps were generated using SnapGene software (B) Graphic representation of exon primers for exon PCRs. White boxes represent 5′UTR and 3′UTR orange boxes represent exons gray boxes represent introns colored half-boxes represent the BsaI restriction sites and the same color represents the complementary overhangs generated after digestion. (A) Schematic diagram of assembly and expression of multiple exons in E. Workflow for assembly and expression of multiple exons in Escherichia coli and Pichia pastoris. The Golden Gate cloning method allows for convenient and rapid cloning in a single-tube, one-step coupling restriction digestion and ligation. It relies on the use of Type IIs restriction enzymes that cleave DNA outside of their recognition site, providing unique cohesive ends that enable directional and seamless cloning of the gene of interest. Golden Gate cloning is a molecular cloning method that allows the researcher to simultaneously and directionally assemble multiple DNA fragments into a single piece. Therefore, a set of strategies was constructed to simultaneously assemble eukaryotic gene exons into prokaryotic and eukaryotic expression plasmids in a one-step reaction through the Golden Gate cloning method, and the target proteins were expressed in both E. Moreover, big genes are more problematic and far more expensive. Although whole-gene synthesis and reverse transcription methods can solve this problem, they are time-consuming, expensive and complicated to operate. However, in most cases, the gene of eukaryote cannot be directly obtained by this method because of containing introns. In addition, obtaining the gene of interest is a prerequisite for heterologous expression, and a common method to obtain the gene of interest is through polymerase chain reaction (PCR) amplification from a genomic template. Therefore, a system that can express the target protein in both E. At the outset, it was unclear which system would be more suitable for expressing the target protein. Selection of a suitable expression system depends on productivity, bioactivity, purpose and physicochemical characteristics of the target protein. pastoris expression systems also have their own disadvantages. pastoris include extensive toolboxes of expression strategies, fast construction speed and low culture costs, when compared with mammalian expression systems. Escherichia coli and Pichia pastoris are the most commonly used microbial cell factories for heterologous protein production.
0 kommentar(er)
